# Different Probes, Same Gene

**URL:** <https://community.brain-map.org/t/different-probes-same-gene/1786>\
**Category:** Technical\
**Tags:** analysis\
**Created:** [August 12, 2022, 3:08am UTC](https://community.brain-map.org/t/different-probes-same-gene/1786 "2022-08-12T03:08:22Z")\
**Posts on this page:** 4\
**Page:** 1

<div class="post-metadata">

**Author:** ![GerrikLabra](https://avatars.discourse-cdn.com/v4/letter/g/7feea3/32.png) [@GerrikLabra](https://community.brain-map.org/u/GerrikLabra)\
**Post date:** [August 12, 2022, 3:08am UTC](https://community.brain-map.org/t/different-probes-same-gene/1786/1 "2022-08-12T03:08:22Z")

</div>

Hey, I am noticed that the probes in the microarray data I downloaded from the All-Br-Atl can cover the same gene. I know that the Probes.csv table shows the level of expression of the genes based on the probe, but I cant find any info on the efficacy of each probe. For example.

Probe Id, Gene ID, Expression1, Expression 2  
1049352, ADAM23,0.3125,0.4084,0.452,  
1049353,ADAM23,0.877,0.9301,

Now, each column corresponds to a row in the Columns.csv. But if ADAM 23 is reported at 0.3125, and 0.877, then what is the correct expression level? I tried to find a probe id key, to see if I could connect the probes to an efficacy value, but can’t discern the correct search phrase.

My working theory I can calculate a weighted valueof the gene expression, or simply use the probe with the highest efficacy. But I need to know what the probes were I think, if I want to make any conclusions.

---

<div class="post-metadata">

**Author:** ![GerrikLabra](https://avatars.discourse-cdn.com/v4/letter/g/7feea3/32.png) [@GerrikLabra](https://community.brain-map.org/u/GerrikLabra)\
**Post date:** [August 29, 2022, 6:09pm UTC](https://community.brain-map.org/t/different-probes-same-gene/1786/2 "2022-08-29T18:09:38Z")

</div>

edit:  
Probe Id, Gene ID, frontal lobe, orbital part  
1049352, ADAM23,0.3125,0.4084,0.452,  
1049353,ADAM23,0.877,0.9301,

NIH used to have a probe database, and its still up for download, but I cant get any efficacy data.  
Currently I am looking at .sts files with gene locations. Looks like this.  
|1|AAAAAAAAAAAAAAGCAAATGTGC|AACCCCAGCACTCCTTGAG|137|SHGC-25164|4|G31614|Homo sapiens|  
|3|AAAAAAAAAAAACCCCAAAACG|GAGAACTTGGAATCCTGTGTCC|156|RH47536|19|-|Homo sapiens|

---

<div class="post-metadata">

**Author:** ![GerrikLabra](https://avatars.discourse-cdn.com/v4/letter/g/7feea3/32.png) [@GerrikLabra](https://community.brain-map.org/u/GerrikLabra)\
**Post date:** [August 29, 2022, 6:10pm UTC](https://community.brain-map.org/t/different-probes-same-gene/1786/3 "2022-08-29T18:10:00Z")

</div>

[https://ftp.ncbi.nih.gov/pub/ProbeDB/legacy\_unists/](https://ftp.ncbi.nih.gov/pub/ProbeDB/legacy_unists/)  
Here is the probe DB

---

<div class="post-metadata">

**Author:** ![jeremyinseattle](https://yyz1.discourse-cdn.com/flex027/user_avatar/community.brain-map.org/jeremyinseattle/32/50_2.png) [@jeremyinseattle](https://community.brain-map.org/u/jeremyinseattle)\
**Post date:** [August 29, 2022, 6:23pm UTC](https://community.brain-map.org/t/different-probes-same-gene/1786/4 "2022-08-29T18:23:12Z")

</div>

I don’t have a specific answer for your question (maybe others do?); however, we did perform [an RNA-seq experiment](https://www.ncbi.nlm.nih.gov/pubmed/24564186) to try and address the differences in results for probes of the same gene. See the response [to this post](https://community.brain-map.org/t/paper-for-rna-seq-data/171/2).